Uses of Class
org.snpeff.snpEffect.testCases.unity.TestCasesBase

Packages that use TestCasesBase

Package	Description
org.snpeff.snpEffect.testCases.integration
org.snpeff.snpEffect.testCases.unity

Uses of TestCasesBase in org.snpeff.snpEffect.testCases.integration

Subclasses of TestCasesBase in org.snpeff.snpEffect.testCases.integration

Modifier and Type	Class	Description
class	TestCasesAnn	Test case

Uses of TestCasesBase in org.snpeff.snpEffect.testCases.unity

Subclasses of TestCasesBase in org.snpeff.snpEffect.testCases.unity

Modifier and Type	Class	Description
class	TestCasesAnnParse	Test case for parsing ANN fields
class	TestCasesApplyDel	Test cases: apply a variant (DEL) to a transcript
class	TestCasesApplyIns	Test cases: apply a variant (INS) to a transcript
class	TestCasesApplyMixed	Test cases: apply a variant (MIXED) to a transcript
class	TestCasesApplyMnp	Test cases: apply a variant (MNP) to a transcript
class	TestCasesApplySnp	Test cases: apply a variant (SNP) to a transcript
class	TestCasesBaseApply	Test case
class	TestCasesBuild	Test case
class	TestCasesCds	Test random SNP changes
class	TestCasesDels	Test random DEL changes
class	TestCasesDnaSequence
class	TestCasesEffectCollapse	Test Splice sites variants
class	TestCasesEffectCollapse2	Test case
class	TestCasesFasta	Test case for FASTA file parsing
class	TestCasesFileIndexChrPos	Test cases for file index (chr:pos index on files)
class	TestCasesHgvs	Test case for basic HGV annotations
class	TestCasesHgvsDnaDup	Test case
class	TestCasesHgvsDnaDupNegative	Test cases for HGVS's 'dup' on the negative strand
class	TestCasesHgvsProtDup	Test case
class	TestCasesIns	Test random SNP changes
class	TestCasesIntergenic	Test intergenic markers
class	TestCasesIntervals
class	TestCasesIntervalVariant	Test random Interval Variants (e.g.
class	TestCasesIntStats
class	TestCasesJaspar	Test case for Jaspar parsing
class	TestCasesMnps	Test random SNP changes
class	TestCasesProteinInteraction	Test cases for protein interaction
class	TestCasesSeekableReader	Seekable file reader test case
class	TestCasesSequenceIndexer
class	TestCasesSnps	Test random SNP changes
class	TestCasesSpliceRegion	Test Splice sites variants
class	TestCasesSpliceSite	Test Splice sites variants
class	TestCasesStructuralDel	Test case Gene: geneId1 1:957-1157, strand: +, id:transcript_0, Protein Exons: 1:957-988 'exon_0_0', rank: 1, frame: ., sequence: gttgcttgaatactgtatagccttgccattgt 1:1045-1057 'exon_0_1', rank: 2, frame: ., sequence: tgtgttgctaact 1:1148-1157 'exon_0_2', rank: 3, frame: ., sequence: agacatggac CDS : gttgcttgaatactgtatagccttgccattgttgtgttgctaactagacatggac Protein : VA*ILYSLAIVVLLTRHG?
class	TestCasesStructuralDup	Test case for structural variants: Duplications
class	TestCasesStructuralInv	Test cases for structural variants: Inversions
class	TestCasesVariantRealignment	Test cases for variant realignment
class	TestCasesVcf	VCF parsing test cases
class	TestCasesZzz	Test playground